Science topics: Biological ScienceMolecular Biology
Science topic
Molecular Biology - Science topic
PCR, Cloning, Restriction Digestion, Ligation, Transformation, Plasmid et al
Questions related to Molecular Biology
Hello,
In the literature, there are some MS/MS results that include hypothetical proteins, which can be shorter than 40 amino acids. I can also find these when I search for an organism in the protein section of NCBI. My question is, would it be absurd if I synthetically synthesize these peptides called hypothetical proteins and test them as drug candidates in certain disease models? Or are studies like the one I mentioned feasible and being conducted? If so, what procedure should I follow? For example, when I find a hypothetical protein, should I first perform a blast and then synthesize and use it if it meets certain conditions?
Is there any chance you could share some references with me that have been done in this manner?
I hope I have been able to convey what I want to ask.
Thank you for your answers.
Example link: https://www.ncbi.nlm.nih.gov/protein?term=txid562%5Borganism%3Aexp%5D+AND+((%2210%22%5BSLEN%5D+%3A+%2220%22%5BSLEN%5D)&cmd=DetailsSearch
We are preparing to write some review articles on molecular biology of human diseases. Is there anybody expert who wants to participate?
My e-mail address: [email protected]
Please write to me and give some info about yourself.
I have been using NEB Hifi Gibson assembly for a couple years now and I've been quite happy with it. I regularly make plasmid constructs with 4-8 fragments, and always >1/4 of the colonies are "perfect," while the remaining ones may have some SNPs at the joining sites, or be misassembled due to a repetitive region.
Some colleagues said that Golden Gate has even higher efficiency. That even with 8 fragments, it is normal for 50-100% of colonies to be perfect. Is that true? Is Golden Gate that perfect?
What are the 3’ end modifications that prevent DNA from being extended by DNA polymerase? Which one has the best blocking effect? Leakage is minimal?
Who (first) proposed/used/coined the term ‘translation’ in biology/genetics? What is the history behind the use of the word? Thank you!
I would like to do genome assembly for the bacteria isolate from the environment. Can any provide me the information or any tutorial? It would be helpful!
thanks!
Hello everyone,
I hope this message finds you doing well.
I am writing to ask you a significant question about whole-virus ELISA and its procedure.
Honestly, it seems that coating a microplate with viruses is not as convenient as some papers mentioned, especially when high accuracy is needed. Now, my question is, is there any particular procedure in order to enhance the efficiency of the coating? For instance, what would we do if we tended to expose viral protein to the microplate better than before, based on your experience?
Thank you
Currently, phenotypic characterization is routinely used in diagnostic laboratories for antibiotic resistance measurement due to its cost-effectiveness. With the advent of molecular diagnostic technologies that offer shorter turnaround times and more comprehensive data on antibiotic resistance, is there any chance that they will replace phenotyping and become standardized in practice?
I am trying to stitch in a 38 amino acid tag to the N-terminal end of my protein (3200bp) to be cloned into a lentiviral vector (~7000bp). The forward primer for the same, along with the overhang and the restriction site, comes about 150bp long. The first round of amplication gives me a band close to about 3000-3500bp along with a lot of other non specific bands at the higher molecular weight range. I then gel elute this specific band and reamplify using it as a template with the same primers but i end up getting a smear on the gel. I have also tried using this gel eluted sample to proceed with the digestion and ligation with my vector but in vain.
My PCR parameters are as follows:
1. 98 degC- 2min
2. 98 degC- 10s
3. 65 degC- 30s (2-4: x25 cycles)
4. 72 degC- 2min
5. 72 degC- 5min
6. 4 degC- hold
I use Q5 polymerase (strangely, I do not get any amplification with Phusion). I have tried a gradient PCR and it generally works in the range of (58-68 degC). I use about 50ng of the plasmid template for amplification. I understand that really long primers hamper the quality of amplification but unfortunately, this is a necessity right now.
I would really appreciate if anyone with experience can help me out here. My molecular biology is not THAT strong so please point out if I am committing any obvious mistakes.
Thanks in advance!
I am trying to extract DNA from serum. I found an article that claimed simple extraction can be done in a single tube -
Here they used a solution containing 6M NaI/13mM EDTA/0.5% sodium N-lauroylsarcosine/10 µg glycogen as a carrier/26mM Tris-HCl, pH 8.
But currently, I don't have NaI and glycogen. So, I am thinking of making a solution with KI + EDTA + sodium lauroyl sulfate + Tris-HCl, pH 8. And finally, use Na-acetate and absolute ethanol for the precipitation of DNA.
What consideration should I take into account to use alternative reagents?
And, in their protocol does it mean the final solution containing all reagent should have a pH 8 or it just means the use of Tris-HCL with pH 8?
Hi!
I am staining iNOS and CD163 in my cells so I am looking for a minus control, expressing neither iNOS nor CD163. But the cell familiar in our lab including panc-1 and 293T seems at least expressing 1 of them. Which cell line is known to not having observable level of these 2 proteins?
Thanks!
I know, IRES enables the coordinated co-expression of two genes with the same vector, used for the expression of two proteins separately.
But I found two kinds of IRES sequences in my plasmid database and literature. Here it is:
IRES:
TCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAA
IRES2:
CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC
Somehow, I want to know what is the difference on the expression level of these two sequences. Someone said IRES2 will decrease the expression of the second gene compared with IRES, is it true? Could IRES keep same expression level of two genes (I know people will suggest 2A peptide, but I do not want to introduce any amino acids on my protein)?
Greetings, dear colleagues!
Our team conducts research on newly discovered SIRC elements in plant genomes ( , which are thought to be MITE transposons losing inverted repeats products, which could influence genome regulation) using bioinformatics, and we plan to conduct experimental molecular biology studies to elucidate the functions of SIRC. The problem is - our team is specialized in molecular bology experiments aiming to reveal the functions of genes, not non-coding DNA elements. That's why I want to ask your expert opinion - what experimental techniques would help to reveal the functions of abundant DNA elements of repetitive nature?
What comes to mind is the creation of mutant lines without several of these elements, but such experiments are too large-scale and can last for years, which is too complicated at the moment.
Another technique that comes to mind is the amplification of certain sequences and examination using circular dichroism spectroscopy to reveal whether given elements have unusual secondary structure like G-quadruplex of triplex DNA etc that could influence processes of genome transcription or replication.
And one more - we thought it could be possible to capture and identify plant proteins that specifically recognize SIRC via some modification of EMSA (electroforetic mobility shift assay) method. Unfortunatelly, up to date we didn't find any mentions of EMSA variant that uses not single purified protein, but whole DNA-free nuclear lysate, with subsequent identification of binding proteins via MALDI-TOF.
What other in vitro experiments could be useful?
A patient with desminopathy (mutation Thr341Pro DES in a heterozygous state) with the progression of the disease has a decrease in taste and smell, immunosuppression, and an increase in IgA in the blood.
Oddly enough, but all this is characteristic of infections, including viral ones. For example, it is known that if the hepatitis C virus is not treated, then death will occur in 20 years.
In the identified case of late onset desminopathy, muscle weakness manifests itself at the age of 30, and death occurs 20 years after the onset of the disease.
Could the desmin mutation in myofibrillar myopathy be caused by an infection?
Perhaps the infection contributes to the progression of desminopathy?
I just found the Platinum SuperFi II DNA Polymerase, which should simplify PCR protocol as it allows uniform annealing temperature of 60°C, but it should also have very high fidelity; >300× higher than Taq Pol, that should be even more than Q5, reported by NEB to have 280× higher fidelity than Taq Pol.
The SuperFi II DNA Polymerase should even allow amplification up to 40 kbp, while Q5 only up to 20 kbp.
This looks like we have new Queen in the HighFidelity DNA Pol area, don't we? Does somebody have experience with this enzyme?
I am getting zero DNA yield after using qiagen purification columns. I finally traced the problem to NEBuffer 3.1, but pH doesn't seem to the cause.
Essentially, I observe:
3 ug of DNA in 50 uL of water ->
qiagen purification column ->
1.5-2.3 ug of DNA
In comparison:
3 ug of DNA, 5 uL of 10X NEBuffer 3.1, bring to 50 uL with water ->
qiagen purification column ->
zero DNA
I thought it was a pH problem -- high pH can cause low efficiency. But I don't think pH is the problem. Because pH strips and qiagen's pH indicator say my pH is okay (pH<7). And I added 20 uL of 3 M sodium acetate (pH 5) and it doesn't fix the low yield at all. I observe:
3 ug of DNA, 5 uL of 10X NEBuffer 3.1, bring to 50 uL with water ->
Add 20 uL of 3 M sodium acetate (pH5) ->
qiagen purification column ->
zero DNA
Why does adding NEBuffer 3.1 cause low yield if not pH problems?
We would like to purchase around 10 thousand DNA oligos in a 96 well format (25 nmol). The cost per base is coming to around Rs 14-15. We wonder if there is any economical option available in the market.
Thank you
Dear ResearchGate Community,
I am reaching out to express my interest in collaborating on the write-up of a research paper related to Cancer Biology, Telomere Biology, and Gut Microbiome. If anyone is working on research based on this field and you are looking for a co-author or contributor to help in the writing process, I am more than willing to be a part of that.
With a strong background in biochemistry and molecular biology, I believe I can bring valuable insights and a fresh perspective to the work. I am committed to maintaining the highest standards of research integrity and would be thrilled to contribute to a meaningful project in this vital area of science.
If you are interested or know someone who might be, please do not hesitate to connect with me directly or drop a comment below.
Thank you for considering this collaboration, and I look forward to potentially working with some of you soon!
Best regards,
Mashal Naeem
#collaboration #researchpaper #research
I am currently doing my PhD project which consists of a lot of cloning of new plasmids I am assembling. Our laboratory generally maintains the collection on JM109 strain. But since I am doing a lot of Gibson Assemblies, I have been using electrocompetent DH10B cells for higher efficiency. My question is, can I use standard protocol of preparation of electrocompetent E. coli on JM109 instead of DH10B?
An unopened Sigma-Aldrich (P4557) phenol solution bottle was shaken (prior to the addition of the Equilibration Buffer) and a gel-like layer formed at the bottom of the bottle. The upper phase is still liquid. The bottle was shaken briefly after the phenol solution was taken out of +4 C. What should be done? Should it be heated in order for it to return to liquid?
I have molecular data (0,1) and a trait with continuous variables. My goal is to detect the significance of markers associated with the trait. Which statistical analysis should I perform? Should I use a t-test, logistic regression, or something else?
Q1
We have animal behavior scores of 4 group, Normal+ctrl virus, Normal+down-regulation virus, Model+ctrl virus and Model+down-regulation virus. It has two factors(Independent Variable): Model and virus. Editors suggested we use two way ANOVA to analyze, and now we obtained main effects of Model (F(1, 56)=201.18, P<0.0001) and virus (F(1, 56)=11.17, P=0.00427), as well as Model × virus interactions (F(1, 56)=16.13, P=0.0007).
If we should continue to calculate? For example, Model+ctrl virus vs. Model+down-regulation virus. We want to confirm the role of virus in Model animals.
Q2
Next, we used chemical drug to treat the Model animals and Normal animal. It has 4 drug concentration. Should we still use two way ANOVA to analyze the behavior scores? We want to know the role of different drug concentration in Model animals. And what do we do after two way ANOVA?
Thanks very very much!!!
It is known that in the early stages of desminopathy the muscles most often affected are: Semitendinosus, Gracilis and Sartorius. What is the reason for the damage to these particular muscles?
User-friendly software tool designed for analyzing the final images generated from Gel Electrophoresis.
Can BHQ quench the fluorescence of FAM in the case shown below?
I am growing small cell lung cancer suspension cells. How do I separate dead cells from live cells while splitting the cells after confluency in flask?
Hi everyone.
I put a ligation reaction containing a 1 vector (~8 kb) and 2 inserts ( 434 and 537 bp) under bellow condition:
vector: 3' xbaI....... AgeI 5'
insert1: 3' xbaI ..... EcoRV 5'
insert2: 3' EcoRV ......AgeI 5'
ratio vector:insert= 1:7 (ratio: 1 vector+ 7 insert 1+ 7 insert 2)
overnight, 4.C
I have some colons but it seems that only one insert exist in the vector! how is it possible ?!
does anyone any suggession to can have the right transformed colons?
Hi all,
I have recently been attempting to add a C-terminal 6xhis tag to my gene of interest. My reverse primer for this consisted of ~20bp homology to the end of the ORF, omitting the STOP codon - 6Xhis tag - XhoI site - Leader sequence. I successfully amplified the gene and subcloned into pJET 1.2. I have screened the clones by PCR and by restriction digest which indicated the gene of interest was successfully cloned. When sequencing, the end of the gene is correct, however, the tag has not been incoorporated and the STOP codon has remained. My assumption is that during the initial PCR, the gene has amplified correctly but the polymerase has not read through to the 6his tag etc. Since tagging primers are so large the Tm's for the whole primer are very high, thus I calculated by Tm based on the 20bp of homology to the target gene. Any help/advice would be much appreciated. Please ask if any other information would be helpful!
I want to remove vector sequence. Which software can be used to do so?
I'm looking for some simple molecular biology lab experiments for under-graduates.
(All I have in the lab is light microscopes, micropipettes, aerobic incubator, spectrophotometer, and other tools...)
Any suggestions (of experiments and materials needed) to make my sessions more beneficial and interesting?
1. How Long does it Take for Tamoxifen to activate Cre and knock out the gene of interest
2. What would the dosing regimen be for rats/mice?
I am designing an experiment where I will be knocking out 5-HT2A receptors in a cell type-specific manner before psilocybin administration to determine the necessity of 5-HT2A receptors in psilocybin's neuroplastic effects.
Hi, everyone! Recently I'm collecting lentivirus. After package in 293T cells, I take the medium, centrifuge at 1000rpm for 5 min to pellet the cells, then take the supernatant and filter by 0.45um filter. After filtering, I add 1/3 volume of concentration liquid to concentrate the virus at 4℃ overnight. I want to use 1500g, 45min to centrifuge the virus down. Will that speed(1500g) and time (45min) work? If it work, will I see virus particle after centrifugation? If not, what speed and time I need to use to centrifuge?
I humbly wish to seek for assistance from molecular biology an bioinformatics experts to get a novel research topics that can be used as seminar and thesis in my masters program. thanks in anticipation
Some (but not all) DNA polymerases such as Klenow fragment, Taq, and Phi 29 DNA polymerase can catalyze strand displacement synthesis. This is evidenced by opening of molecular beacons and Loop Mediated Isothermal amplification (LAMP).
in strand displacement synthesis, the primer strand is extended using the template strand and each nucleotide incorporated displaces the 3rd strand that was originally annealed to the template?
where is the third DNA strand? the one being displaced? crystal structures and cryo-EM structures of linear primer template dsDNA structures with magnesium and dNTPs and DNA polymerases are not informative about where 3rd strand of DNA is. The displaced strand is not the template and is not the primer.
Where is the displaced 3rd strand of DNA?
At a fixed voltage of 260V, electrophoresis of protein was faster in our previous batch of 1x SDS running buffer. However, the electrophoresis was much slower recently with much lower current (less than half of the previous one). The same issue occurs even with new dilution of freshly prepared 10x buffer to the 1x buffer. What would be the possible reasons of such issue?
Hello I have been trying to transform pet28b plasmids into Rosetta cells. I have tried two plasmids that already show expression in BL21 ( DE3) cells. Is there a list of compatible plasmids that can only be transformed into Rosetta cells? Also, does the factor that Rosetta cells have a resistant gene to Cloramphenicol has something to do? because my pet28b plasmid has a resistant gene to Kanamycin
I am relatively new to conducting Western blots. I employed the alkaline lysis method to extract whole proteins from yeast. Subsequently, I introduced the Opti Protein Marker (ABM, CAT log NO: G252) and completed the gel electrophoresis. The proteins were then transferred to a nitrocellulose membrane using the wet transfer method. Following the transfer, I performed a Ponceau staining, during which the protein markers were clearly visible.
Moving forward, I proceeded to block the membrane for 1 hour in 5% BSA in TBST (Initially, I attempted blocking with 5% non-fat skimmed milk, but encountered high background signals). Subsequent to blocking, I washed the membrane with TBST (3 x 7 mins) and TBS (1 x 5 min). Following this, I incubated the membrane overnight at 4 degrees Celsius with a primary antibody (Beta-tubulin, Rabbit IgG Polyclonal), 1:1000 dilution in 5% BSA in TBST). Afterward, I repeated the washing steps with TBST (3 x 7 mins) and TBS (1 x 5 min).
For the next step, I incubated the membrane with a secondary antibody (Rabbit anti-Goat IgG (H+L), HRP, Polyclonal, 1:10,000 diluted with 5% non-fat skimmed milk in TBST) for 3 hours. Subsequently, I performed additional washes with TBST (3 x 7 mins) and TBS (1 x 5 min). Finally, I carried out chemiluminescence detection with an exposure time of 30 seconds.
However, my results were unsatisfactory as I observed multiple nonspecific bands, and the protein marker disappeared. I seek assistance from experienced researchers, especially those familiar with Western blotting of yeast proteins. I would appreciate any insights or suggestions to identify and resolve the issues.
Additionally, please refrain from suggesting the use of monoclonal antibodies, as it is currently beyond my budget constraints.
Thank you in advance for your help.
Dear all,
I want to express my protein of intterest in absence of salt. Now the challenge is to see the survival of cells and even if it survives, where I could find a cell medium (any company that provide it). Please recommend if any commerically available media that has no salt.
Thank you
With kind regards
Prem
Gel electrophoresis, recombinant protein, expression in bacteria, molecular biology
I want to find the UTR sequence of mRNA sequence of bacteria protein. Can anyone suggest a insilico process for that
My target protein is a membrane protein and I want to check its expression level in the test sample using western blot. Can anyone suggest which protein should be used for loading control, like we use beta-actin in cytosolic proteins. And is there antibody available for that ?
Hi y'all,
I am running into some difficulties with qPCR (SYBR). To give y'all a brief background summary, I transfected some cells (ASO) and am running qPCR to see its effect on known genes using qRT-PCR. The first time I ran a qPCR, I saw little to no amplification. I re-ran it again and this time I went back to the beginning (RT-PCR from the original RNA) and was able to get some data. However, I am running another qRT-PCR but this time it's not working at all, as in I am seeing zero amplification, which is weird because, again, we know for a fact that some of the genes are supposed to show up in abundance. I was very careful throughout the whole process, so I don't think there was any human error. I haven't run a gel yet, so that's something that I have in my mind. I just wanted to see if y'all have faced similar problems.
Thanks in advance!
I've read that template-switching can create duplications, but those duplications are inverted (aka TIDs - tandem inverted duplications).
Can template-switching result in a non-inverted duplication as well? If so please pass reference to me. Thanks!
Why Molecular biology the the cell and a very rputable book in biology. It does not contain any intext citation and only has a list of suggested reading. Anuone knows whY?
Sincere greetings
My academic English writing is excellent. I desired to join several active groups within my field. My concentration is in molecular genetics. But I was unable to locate any. I would appreciate it if you could help me join scientific groups that study cancer and non-coding RNAs. Please inform me if a professor needs a remote colleague for paraphrasing and academic editing, especially in Germany. My affiliation will be the host affiliation.
As I am very creative and punctual, I will rewrite very soon.
I am ready for a test on paraphrasing a paragraph.
Best wishes
Hi, I'm working on E. coli O157:H1 bacteria isolated from vegetables... how can I do a genetic confirmatory test? PCR but with which specific gene primer?! if there is someone who has worked on it, help me please with kind regards.
If an active site mutant knocks out product formation at all excessive concentrations of substrate and at all excessive concentrations enzyme, but substrate binding affinity via anisotropy shows no difference in binding affinity for wildtype versus active site mutant enzyme, is kcat = 0? But if kcat = 0, then by the relationship of Michaelis constant (KM) to kcat then KM = KD.
How do you show to reviewers that the active site mutant is dead? If the wildtype mutant starts producing product in seconds, are you supposed to measure the reaction for the mutant for an hour at zero concentration of substrate and at 100fold excess substrate concentration of the K_M for the wildtype enzyme for the active site mutant, and show the time course?
Are there any publications that show a mutant enzyme is not just slow to produce product but is rather incapable of producing product but can still bind substrate? Examples would be greatly appreciated!
molecular biology and molecular genetics laboratories. It is a reagent designed for the removal of ribonucleases (RNases) and other nucleic acid contaminants, such as RNA, that can degrade nucleic acid samples, such as DNA.
Dear all
How to find a full fund to establish a molecular biology Diagnostic lab for cancer from scratch ?
I am designing primers for my study. I couldn't find answer to my question anywhere.
I will try to see the effects of a drug on transcript levels of different genes.
I intent to cover all mRNA transcripts so that i won't miss anything for the moment and my study in current state, doesn't search for transcript variants.
I am using Blast's "primers for a common group of sequences." and it does wonders.
But i can't be sure about these predicted transcripts and for different genes i encounter different hardships for group specific primers. So my question is, are these
predicted (Xm_) transcripts:
- Necessary to cover all the possible gene transcription,
- Doesn't matter too much to include or not,
- Or should be avoided at all costs?
(A bonus question: Some small transcripts like, Agtr1a, has two exons.
Blast can't design a primer with optimal length, Tm, GC etc. features when i ask for an exon junction or intron spanning primer. I wonder what is my best option here
- Design a bad length, bad Tm, bad GC primer for the sake of Genomic purity,
- or a proper length, Tm and GC but "dirty" primer and leave the job to DNAase?)
I'm sory if my terminology is a bit raw. I am a physiologist and it is my first try with primer design and PCR.
Fields:
Cell and Molecular Biology
Biochemistry
Physiology
Microbiology
I would like to buildup a small active research group including a comprhensive subspecialities in Clinical Biochemistry, Molecular Biology, Internal medicine, statisticians to be shared in writing research articles, review, chapters and books. Who see him a suitable he can comment here with his email or whatsapp no to communicate later.
total Dna extraction from poultry tissue, kidney, liver, heart using spin column.
I am currently optimizing a RPA-based protocol. As everyone knows, this nucleic acid amplification technique is based on isothermal amplification (around 37-42˚C) in combination with recombinases and single-stranded DNA binding (SSB) proteins.
I have designed several candidate primers to optimize my RPA. All of them were searched in literature and designed considering the criteria to be used in an RPA reaction.
These same primers were verified by conventional PCR (At different Tm: 55-65ºC), obtaining a successful result.
The problem started when I used the RPA master mix (lyo version from Twistdx) and performed the RPA reaction with the same primers and samples used in the conventional PCR. ALL THE RESULTS BECAME NEGATIVE?!
Primer concentrations used in RPA reaction was 400nm (recommended by twistdx) and the reaction time was 30 minutes at 39 °C (conditions recommended for the set of primers tested). Visualization of the amplification was done on agarose gel (1.5%) and doing a posterior melting curve assay. In all cases, no amplification was detected.
Does any one have a clue on what is happening???
I don´t know which other variables I can change to obtain good results
Suggestions?
Thank you
I am trying to express several proteins at the same time, but I want to use a different promoter and terminator for each one to avoid the possibility of recombination.
The promoters that are available to me are: TEF2, PGK1, CCW2, TDH3 and HHF2. The available terminators are: ENO1, SSA1, ADH1, PGK1 and ENO2.
Has anyone ever used these combinations of promoters and terminators? In your experience, which combinations work the best?
Is there anyone who has done TaqMan assays using average regular use PCR mastermix (not the TaqMan assay specific mastermixe) using cDNA as template for the qPCR test? I wanted to know the ins and outs of the procedure and the optimization you did to get accurate results.
Thanks in advance.
Greetings, it is mentioned in your site that your research regarding cellular and molecular biology is also published (indexed) in pubmed, however i cannot seem to find it. could you please help me?
Hello every one,
I'm working on the in vitro expression regulation of a viral gene.
I'm looking at the splicing efficiency of several versions of the gene (comming from different genotypes). To do so I cloned the various versions of the gene in a pcDNA3.1 vector.
When expressed in eukaryotic cells, all vector expression but one give me the expected splicing pattern.
The odd one use a new splice site really close to the CDS start never reported in the litterature and absent in all other version of the gene.
The gene in the pcDNA3.1 is under the strong pCMV promoter which also add a 150ish base pair 5'UTR to the mRNA. Whereas, in vivo viral mRNA have a very short 5'UTR or none at all.
I was wondering if the 5'UTR addition and/or the strong expression could suffice to force this artefactual splicing ?
Thank you for your time !
Philippe.
Is there any manual way to isolate recombinant fosmid DNA from E.coli cells in the absence of isolation Kit?
I am very curious about the ecology of Chroococcidiopsis thermalis PCC 7203. Does someone have an information about the chemistry of a spring and its temperature where Chroococcidiopsis thermalis PCC 7203 had been isolated from? Who did isolate this culture? Thanks. IB
We are focusing on Biotechnology, Food Technology, and Molecular Biology students.
I'm struggling to publish my work because I cannot find a good journal with less publication fee as most of the good journals are charging more than $2000. My work is based on colorimetric LAMP assay with a novel fluorescent dye.
Hello to all my fellow Biologists.
I have resorted to posting this question as my last desperate attempt to find a place for myself in the world of biotechnology.
I am a first class student with relatively good grades (GPA 3.77/4.00) in BSc. of Biotechnology (Hons), excellent extra-curriculars and competitions under my belt, 6 months of work as a Field/Research Assistant and 4 years of previous work experience in events management. I have experience in the microbiology, molecular biology, antivirals, nutraceuticals and cell culture disciplines. I have also taken a great liking to scientific communication and create visual content to make biology simpler for the Layman, both bother and in my own time.
Despite all this, I haven't had a single postgraduate application succeed for the last 2 years. And though I do understand there is high competition for available spots, I also wonder what I may be lacking despite some telling me I have an "impressive CV" and can do a direct PhD.
It is unfortunate however that my family is not doing financially well, therefore I can only afford opportunities with a scholarship or that are work/salary-based. Perhaps this narrows available opportunities but regardless, studentship scholarships have very evidently not opted for me, simply because "there were too many applicants this time around". Perhaps lacking funds is not enough of a criteria? (Hint of sarcasm).
Additionally, I was born and raised in the UAE (I do not get citizenship), therefore I am also looking for a potential country to eventually settle down in while doing the work I love.
I would greatly appreciate if anyone would know of opportunities I may be able to apply for like fully funded PhDs, or skilled/summer programs and workshops/internships, or even Research or Lab assistant positions you or someone you know may be looking for, because unfortunately, I'm 2 rejections away from being completely out of options.
I would greatly appreciate any input you may have or can share with me! I have also added my CV for your reference.
I don't want my impression of the field I love to be tainted with nothing but rejections, and to settle for a job outside our field simply because I had no other choice.
I look forward to hearing from you all.
Sincerely,
Zahraa Ozeer
Molecular dynamics simulation , bioinformatics , molecular docking
Hi everyone, I've tried to transfer initially using a 20% methanol transfer buffer using 250mA max current for 70 mins, all I got was transfer of mid-high range proteins, I suppose all proteins below 20 kDa escaped the membrane from the other side. Anyone has any experience with blotting 5kDa +- peptides and can share tips?
I am looking for a PhD Position in Microbiology, Virology, and Molecular Biology.
I know many websites have simple tools like transcription and translation available, but are there any analysis tools that researchers need that either do not exist or are not publicly available? It could be anything from algorithms to visuals. Thanks!
I’m trying to reproduce the library transformation efficiencies seen in this 2010 paper:
in which they claim 1.5 x 10^8 cf/ug DNA. My intact circular vector is the same size as their pcr product + linearized vector, but I’m getting 10^5 ish transformants/ug, similar to chemical transformation with the zymo kit.
Has anyone successfully done this? so far we’ve tried different electroporators, voltages, recovery media, etc but nothing seems to be working.
Any other ideas or troubleshooting would be much appreciated, thanks in advance
I would like to add BG-azide to cells for SNAP tag pulldown however I don't know whether it is going to be cell permeable. My instinct is to day yes it will be but neither me nor the supplier know whether that is true. I thought I would ask if anyone has tried something similar, even though that is unlikely... I have attached the structures in case that is informative
These are the products https://www.iris-biotech.de/global/rl-3950 and https://www.iris-biotech.de/global/rl-3960
Yes unanimous agrregation of protein is cause of neurodegegenerative symptoms of molecular biology means bad disease of suffering like Parkinson,Alzheimer's etc .
In a patient with desminopathy (mutation Thr341Pro DES in the heterozygous state) with the progression of the disease, we note signs and symptoms that are also characteristic of botulism: bradycardia, arrhythmia, AV blockade, a significant decrease in the average duration of motor unit potentials according to electroneuromyography, paresis and paralysis of the striated muscles, decreased sweating, paresis of the gastrointestinal tract, dry eyes, dry mouth, symmetry of neurological symptoms, hoarseness, impaired visual acuity, doubling of objects occurs, progressive muscle weakness. These signs and symptoms are characteristic of botulism, only when a case of desminopathy is detected, they proceed slowly.
Hi everyone.
I have protein with concentration of 0.6 mg/mL
The total volume of my protein is 4 mL.
Protein size is ~18 kDa
How can I convert my total protein concentration to micro molar?
Thank you.
I'm optimising a new RNA extraction protocol from yeast. The RNA extraction with formamide works great (the yield of RNA mass/YDM is even better than our established protocol) but the final volume of formamide in which the cells are disrupted makes the sample very diluted. I was thinking of ethanol or LiCl precipitation, maybe using SpeedVac (although formamide boiling point at normal conditions is 210°C so I'm not sure how possible this is; for two-phase extraction the only common solvent it doesn't mix with is diethyl ether which does not dissolve nucleic acids well). As the formamide extraction protocols don't seem popular, the published sources are very limited. Does anyone have experience concentrating RNA in formamide?
I have a tube of antibodies marked by the manufacturer that can stain frozen sections and paraffin sections for immunofluorescence, but the manufacturer did not indicate whether it can stain immunofluorescence of cells. I wonder if such antibodies can also be used to stain cells for immunofluorescence. Has anyone encountered a similar problem, looking for your answer.
I used to activate my PVDF with methanol for 5 minutes, then I did transfer as usual. But these days twice I got the same results, which is there is a block white marks in between after I finished my fast-green staining. I do believe those are not bubbles formation.
Some student suggest me to wash the PVDF first with water then continue transfer and so on.
I confuse, what's wrong with my technical transfer. I have never facing this situation before.
If we take a gel picture (Image attached) then in lane 1 and 2, all the bands are Polymorphic bands? or they are monomorphic?
Hi I am looking for any alternative protocols to purify TMV virions, other than the commonly used PEG precipitation.
Two main problems that I have with PEG protocol is that,
1\ any macromolecule will co-precipitate as well
2\ so that PEG cannot purify full length (300nm) TMV virions from other shorter rods (probably breakage), and other small discs. (thanks to people responded to my earlier question)
So I am wondering if there is any purification protocol or method that can get mostly the full length rods and rid breakage ones and discs?
Thanks a lot in advance
Sometimes it may be difficult or expensive to carry experiments by yourself. If commercial companies can do that at a satisfactory cost, our ideas can be translated into experimental results faster and with better expertise. I was thinking if that can be done.
Sometimes we may try to do some molecular, immunological or mouse experiments if the experiments do not require specific patient samples and starting data can be emailed in soft copies.
If anyone have idea, please help inform me.
Hi everyone,
we recently switched most of our -80°C freezers to the absolutely scorching -70°C in my lab.
We did so because apparently the -80°C guideline originated from a technical limit imposed by the cooling fluid used back in the day. Thus it has nothing to do with a potential increase of our beloved samples stability over time.
It has no impact on sample life BUT the energy spent for going lower and lower in temperature increase exponentially. From what i can remember the increase in energy cost could be as high as 30%.
Here are some resources on the subject.
What do you think of that ?
Hello,
I am finishing a Ph.D in biomedical sciences, I have a master in molecular biology and I know self-taught programming in Python and C. Do you think I could apply for a computational biology post-doc?
What could I do to be competitive? Would a Github with example of my codes and programming certificates from Coursera enough?
Thanks
I was hoping that some of you might be able to help me set up an experiment in which I want to measure telomere length of MNCs (of a certain patient population) by Flow-FISH. As I'm completely new to this I'm running into a whole bunch of issues. If you have thoughts on any of them, feel free to comment.
First off, what probes are best to use? Traditionally people use PNA probes, but Exiqon also seems to offer LNA probes these days, are those any good? Others say Bridged Nucleic Acids (BNAs) are the new hotness. If sticking to PNA, who has experience for a good supplier for the EU?
I just want a general (though accurate) estimate for telomere length per patient. Should I get TelG or TelG probes, or both and mix them? Also, I want to use a green fluorophore, AF488 is a lot more expensive than FITC, are signals so weak that it merits the extra $$?
Assuming it's best to include a DNA dye to correct for pleudity, I was thinking of using LDS751, but considering the plethora of new dyes out there I'm open for alternatives. Will 7-AAD work for cell cycle analysis, or one the new patent dyes (RedDot2, DyeCycle Ruby)? It needs to be excited by the 488 laser and emit in the red spectrum as not to give too much overlap with my FITC signal. Also as little as possible excitation with the HeNe laser would be nice, as I need that for other stuff.
I want to use a RALA peptide vector, and I have found that some studies centrifuge the plasmid/RALA complexes and resuspend the pellet before use, while others seem not to do so. It seems like the studies that don't centrifuge end up with smaller particle sizes than the studies that do centrifuge, but I haven't been able to find any definitive confirmation of this trend. Intuitively, it seems like spinning them at 10k RPM would mash them together to some extent, possibly causing aggregation/melding of the particles and lead to larger particle sizes after resuspension. The only advantage to centrifuging and resuspending I can see is that it would eliminate any toxic effects of free floating/non-encapsulated plasmid, but this wouldn't even really be a concern in vitro, right? Does anybody know of a study that has investigated this? Thanks.
It could include biochemical or molecular biology techniques.
Good time, dear, I need a journal article clarivate about cancer, immunology, and molecular biology and is easy to accept. PhD student and final year thanks and best regards
Hello!
I am using DNeasy PowerBiofilm Kit to isolate DNA from skin swabs. Now I am considering if I should use the provided collection tubes to final storage of extracted DNA. DNA can bind to plastic walls of the tube, so should I rather use low-DNA binding tubes from Eppendorf? On the other hand, the kit has been made for the extraction of DNA from various types of source samples, so it should be appropriate for DNA storage, despite nowhere is wrote that the tubes are DNA-low binding?
Any suggestions?
Martin
Hello, I am working with cell culture and I need some advice. I usually use trypsin to detach the cells from the flask, but I wonder if I can stop the trypsin reaction with serum-free medium instead of serum-containing medium. Is this possible or will it affect the cell viability and growth? How do you subculture your cells with trypsin? Thank you for your help.
In some cases the -10 of the promoter is known, while in others it is not.
In that case how do we predict the transcription start site (TSS)?
I have tried using the popular tools available. They give inconsistent results compared to some of the characterized promoters and transcription start site.
The bacteria I am using is Lactococcus lactis NZ9000.
Thank you in advance.
We are working on Biofilm and Quorum sensing genes of E.coli, we suggest some of reasons maybe:- Contamination, Annealing Temperature, Melting Temperature, DNA Extraction mistakes in the Techniques, we identified them by biochemical tests to be sure the isolates are E.coli, but now we are collecting samples from the beginning and doing the procedure again
Hello,
I am designing a plasmid with an SV40 promoter-driven antibiotic resistance. Does expression from an SV40 promoter require a TATA box upstream of the transcription start site? The original vector had a TATA box at -30, however this is lost in my cloning strategy. With my current plan, the transcription start site is just 8bp from the end of the SV40 promoter. Will this allow for expression, or is a TATA box needed?
Thanks!
I need to do a primary culture of Non parenquimatic liver cells from mice and althought, I have the protocol for the obtaining and isolation of these cells, I do not know which medium to use, what porcentage of FBS use and what and how much supplements use (like Glutamine, antibiotics, etc).
I would really appreciate the help!
Could you please list some common methods for identifying the binding pocket? I mean we have a compound and a protein of interest, so which domain of the protein will be binding with the compound? And my major is molecular biology. How can I verify the binding pocket with the methods in my field? Thank you very much!!
Hello,
I did a Gibson Assembly and after the assembly I stored them on ice, but forgot to put them in -20 degrees. This was at the end of the day. The next morning I saw that the ice was melted and therefore they havent been on ice but water for the night and part of the morning. When I saw this, I immediately stored them in -20 degrees. Now my question is: are they still good to use?
Thanks
"The result shows absence of intragenomic variation among 16S rDNA gene and presence of variable regions among the 16S rDNA sequences (intergenomic variation), noticing for example high variability around 800, 900, and 1000 bp and a large conserved region between 1150 and 1350 bp. This information allowed us to discard the restriction enzymes FnuII, AsuI, FokI, Eco57I that recognized some restriction sites contained within variable regions, since they are more susceptible of acquiring future nucleotidic variations and with this, the potential generation of different band patterns." [1]
I add that the article mentioned that these discarded enzymes were targeting conserved sites in the study species.
[1]Mandakovic D, Glasner B, Maldonado J, Aravena P, González M, Cambiazo V, Pulgar R. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP. Front Microbiol. 2016 May 9;7:643. doi: 10.3389/fmicb.2016.00643. PMID: 27242682; PMCID: PMC4860512.
Is my reading right that the article implies that there is such potential? If yes, what are the possible mechanisms?
More important, what's the time frame of this "future nucleotidic variation", is it an evolutionary time frame that could take thousands of years?
Edit: i think my question can be thought of as: How common are new 16s rRNA gene variants in bacterial species?
I obtained the EnzChek peptidase/protease assay kit. I carried out the assay according to the manufacturer's instruction using a microplate and read at excitation/emmission of 490/520 but i got OVERFLW readings even for the negative control. Anyone with prior experience?
biofilm and quorum sensing genes of E.coli, not used drug but chemical material (Thiophene)
Hello everyone,
I am running a qPCR assay. I chose gradient temperature option for each of my primer to get the best conditions the amplification happens (without heterodimers- NA in negative controls). However, I have seen that my housekeeping gene and one of my target gene have different annealing temperature. Can I run another qPCR set-up just for this gene by choosing gradient temperature option ? For instance; my gene in question in a row with 54C and housekeeping gene in a row with 60C. I think as far as the machine reads the signals at the same time, it won't pose a problem but I just want to make sure.
Many thanks,
Tuba
I want the manual of molecular cell biology by Bruse Albert
This would be similar in concept to using molecular biology’s BLAST algorithm.